Detail of Probeset Mtr.32341.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.32341.1.S1_at
Species Medicago truncatula
Annotation AW688924 /FEA=mRNA /DEF=similar to UP|Q7XJ60 (Q7XJ60) At3g47690, partial (45%)
Mapped public sequence ID AW688924
Gene Ontology GO:0005515 GO:0005575 GO:0005819 GO:0005874 GO:0008150 GO:0030981 GO:0031115 GO:0051010 GO:0000022 GO:0000235 GO:0000236 GO:0000776 GO:0000910 GO:0000922 GO:0005813 GO:0008017 GO:0031143 GO:0031252 GO:0031592 GO:0042803 GO:0045502 GO:0051225
KEGG K10436
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence tttctctttctttctgcgaaaatggcgacgaatata