| Detail of Probeset Mtr.32677.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.32677.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BE315795 /FEA=mRNA /DEF=similar to UP|O25217 (O25217) Glutathione-regulated potassium-efflux system protein (KefB), partial (2%) |
| Mapped public sequence ID |
BE315795 |
| Gene Ontology |
GO:0003674 GO:0003729 GO:0005575 GO:0006911 GO:0008150 |
| KEGG |
K23905 |
| Transporter |
|
| Transcription Factor |
C2H2 |
| Mapped unigene in the TRICHOME database |
TCMT45328 |
| Target sequence |
ttttacgcttcccaaccgaatatgatcgttccacaa |