| Detail of Probeset Mtr.32678.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.32678.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
BE316215 /FEA=mRNA /DEF=weakly similar to UP|Q9FPT0 (Q9FPT0) Ubiquitin-specific protease 14, partial (3%) |
| Mapped public sequence ID |
BE316215 |
| Gene Ontology |
GO:0004197 GO:0004221 GO:0005515 GO:0005575 GO:0005634 GO:0005730 GO:0005737 GO:0005764 |
| KEGG |
K01072 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BE318850 BE316215
|
| Target sequence |
gatgtatcagttgctgttcctaagatcttaaatatcagtggtatgcgcagcaagggtcgt
caacctggggaagagctctattcagatacacatgtgaccgatgaatatctccctgatgga
aa |