| Detail of Probeset Mtr.32932.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.32932.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
BF634254 /FEA=mRNA /DEF=weakly similar to UP|Q39079 (Q39079) J-domain protein, partial (14%) |
| Mapped public sequence ID |
BF634254 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0005743 GO:0006457 GO:0008150 GO:0031072 GO:0051082 |
| KEGG |
K09531 |
| Transporter |
3.A.5 3.A.5.8.1 3.A.5.9.1 |
| Transcription Factor |
C2H2 MYB |
| Mapped unigene in the TRICHOME database |
BF634254 AW690207
|
| Target sequence |
tggaacttggttccaggttggatagagcctgaagagattaaagccgagttggagaggttg
aagagaagaagggaacatgagaagatggtggctaattttcagtcttccgggacgattttg
gctaatttgtccatgccgcagtatttagatggtgatggt |