| Detail of Probeset Mtr.32971.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.32971.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BF635478 /FEA=mRNA /DEF=PIR|C86439|C86439 protein T19E23.13 [imported] - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (97%) |
| Mapped public sequence ID |
BF635478 |
| Gene Ontology |
GO:0000209 GO:0000902 GO:0005737 GO:0006513 GO:0006950 GO:0016567 GO:0016579 GO:0030437 GO:0030447 GO:0031386 GO:0043008 |
| KEGG |
K08770 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BF635478 |
| Target sequence |
gagggagtcatttggtgctaatcagaactgggactgggcagtcttgtatctctcgaatat
ccagggatctacataactttatgctcatatatgct |