Detail of Probeset Mtr.32971.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.32971.1.S1_at
Species Medicago truncatula
Annotation BF635478 /FEA=mRNA /DEF=PIR|C86439|C86439 protein T19E23.13 [imported] - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (97%)
Mapped public sequence ID BF635478
Gene Ontology GO:0000209 GO:0000902 GO:0005737 GO:0006513 GO:0006950 GO:0016567 GO:0016579 GO:0030437 GO:0030447 GO:0031386 GO:0043008
KEGG K08770
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database BF635478  
Target sequence gagggagtcatttggtgctaatcagaactgggactgggcagtcttgtatctctcgaatat
ccagggatctacataactttatgctcatatatgct