Detail of Probeset Mtr.33174.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.33174.1.S1_at
Species Medicago truncatula
Annotation BF645335 /FEA=mRNA /DEF=similar to UP|Q6TBQ2 (Q6TBQ2) Glycinamide ribonucleotide synthetase , partial (22%)
Mapped public sequence ID BF645335
Gene Ontology GO:0004637 GO:0004641 GO:0004644 GO:0005515 GO:0005575 GO:0005634 GO:0005730 GO:0005739 GO:0005829 GO:0006189 GO:0010033 GO:0010035 GO:0048513 GO:0009152
KEGG K01945
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database BF645335  
Target sequence cttttgattccgcaaattcgattactttatcttcgtagaatgtcttgcactact