Detail of Probeset Mtr.33213.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.33213.1.S1_at
Species Medicago truncatula
Annotation BF646633 /FEA=mRNA /DEF=
Mapped public sequence ID BF646633
Gene Ontology GO:0001664 GO:0003924 GO:0005515 GO:0005525 GO:0005829 GO:0005834 GO:0005886 GO:0006935 GO:0006972 GO:0007188 GO:0007189 GO:0031152 GO:0031284 GO:0042048 GO:0045762 GO:0046578
KEGG K04640
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database DY616605  BF646633  
Target sequence ttcagaggaattgaacgaatccctttgccgatgtcacgtatttccggtgtgacgggatct
nctaatcatagtccaagggtctcgggaagttca