Detail of Probeset Mtr.33225.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.33225.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
BF646991 /FEA=mRNA /DEF=homologue to UP|SARB_ARATH (Q01474) GTP-binding protein SAR1B, partial (22%) |
Mapped public sequence ID |
BF646991 |
Gene Ontology |
GO:0003924 GO:0005525 GO:0005737 GO:0005783 GO:0005789 GO:0005813 GO:0006886 GO:0006888 GO:0006998 GO:0007264 GO:0030127 GO:0045335 |
KEGG |
K07977 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
BI266674 TCMT46822
BF646991 |
Target sequence |
attggttttatggaattcttgctacccttggtctgtggcaaaaagaggccaaaattttat
ttttagggttggataatgctggcaaaacgactttgcttcacatgcttaaagac |