Detail of Probeset Mtr.33291.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.33291.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
BF649374 /FEA=mRNA /DEF=homologue to GB|AAG40371.1|11762186|AF325019 AT4g27960 {Arabidopsis thaliana;} , partial (15%) |
Mapped public sequence ID |
BF649374 |
Gene Ontology |
GO:0000070 GO:0000209 GO:0000502 GO:0004842 GO:0005634 GO:0005829 GO:0006508 GO:0006513 GO:0006950 GO:0008054 GO:0016567 GO:0030437 GO:0043162 GO:0045454 GO:0048308 GO:0051248 GO:0005575 |
KEGG |
K06689 |
Transporter |
9.A.5 9.A.5.1.1 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
CO514307 TCMS41111
CX528549 BF649374
TCMT49473 |
Target sequence |
ctttgatttgagcatggcatcgaaacggatcctcaaggagctcaaggatttgcagaagga
tccaccaacatcatgcagcgcaggt |