Detail of Probeset Mtr.33291.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.33291.1.S1_s_at
Species Medicago truncatula
Annotation BF649374 /FEA=mRNA /DEF=homologue to GB|AAG40371.1|11762186|AF325019 AT4g27960 {Arabidopsis thaliana;} , partial (15%)
Mapped public sequence ID BF649374
Gene Ontology GO:0000070 GO:0000209 GO:0000502 GO:0004842 GO:0005634 GO:0005829 GO:0006508 GO:0006513 GO:0006950 GO:0008054 GO:0016567 GO:0030437 GO:0043162 GO:0045454 GO:0048308 GO:0051248 GO:0005575
KEGG K06689
Transporter 9.A.5 9.A.5.1.1
Transcription Factor
Mapped unigene in the TRICHOME database CO514307  TCMS41111  
CX528549  BF649374  
TCMT49473  
Target sequence ctttgatttgagcatggcatcgaaacggatcctcaaggagctcaaggatttgcagaagga
tccaccaacatcatgcagcgcaggt