| Detail of Probeset Mtr.33313.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.33313.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
BF650036 /FEA=mRNA /DEF=homologue to UP|Q9LIQ6 (Q9LIQ6) Arabidopsis thaliana genomic DNA chromosome 3 BAC clone:F14O13, partial (6%) |
| Mapped public sequence ID |
BF650036 |
| Gene Ontology |
GO:0005515 GO:0005634 GO:0006473 GO:0006915 GO:0007050 GO:0008285 GO:0045892 GO:0045926 |
| KEGG |
K11345 K11346 |
| Transporter |
|
| Transcription Factor |
PHD |
| Mapped unigene in the TRICHOME database |
TCMT43678 BF650036
|
| Target sequence |
gaaaccctaatgtcattccttgaagaatttcaagccaatttggattcacctgcctaatat
tcttcataagaagtatgccttattgcgtgacctagataaaagtttacaa |