| Detail of Probeset Mtr.33358.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.33358.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
BG447658 /FEA=mRNA /DEF=homologue to PIR|S41432|S41432 GTP-binding protein, ras-like (clone vfa-yptx) - fava bean {Vicia faba;} , partial (27%) |
| Mapped public sequence ID |
BG447658 |
| Gene Ontology |
GO:0003924 GO:0005525 GO:0005768 GO:0005811 GO:0005813 GO:0006897 GO:0007317 GO:0007349 GO:0008103 GO:0016360 GO:0019730 GO:0022416 GO:0030140 GO:0031532 GO:0042052 GO:0042493 GO:0043195 GO:0048477 GO:0048749 GO:0050807 GO:0005802 |
| KEGG |
K07976 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT48160 BG447658
|
| Target sequence |
ctgttgcttcataagtattggagaaagccagaatccatgatggctgtttattgttgattt
gtttctacctaccggaaagtcagtaactcttgggactcgcagatggcatttaata |
