| Detail of Probeset Mtr.33426.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.33426.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BG450094 /FEA=mRNA /DEF=similar to UP|Q7DM58 (Q7DM58) MRP-like ABC transporter (Fragment), partial (13%) |
| Mapped public sequence ID |
BG450094 |
| Gene Ontology |
GO:0005515 GO:0005624 GO:0005887 GO:0006855 GO:0006979 GO:0008514 GO:0009408 GO:0015711 GO:0015732 GO:0016020 GO:0016324 GO:0030644 GO:0031427 GO:0042493 GO:0043627 GO:0046581 GO:0046685 GO:0048545 GO:0008559 GO:0010033 GO:0010243 GO:0014070 GO:0015238 GO:0015432 GO:0015722 GO:0015893 GO:0016323 GO:0032355 GO:0032496 GO:0042626 |
| KEGG |
K05666 K05667 |
| Transporter |
3.A.1 3.A.1.208 3.A.1.208.14 3.A.1.208.2 3.A.1.208.8 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT60950 |
| Target sequence |
atcatagttatgatggtagatccaaatttcttgttattagagatataaagtttggcttaa
tctttcttttcttgatttctgcatcattctggcgctgttgctagaatcatagtatataat
tggtttttttttttttccaagcaaattcaactcattt |