| Detail of Probeset Mtr.33482.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.33482.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | BG451783 /FEA=mRNA /DEF=similar to UP|CAH2_FLALI (P46513) Carbonic anhydrase 2 (Carbonate dehydratase 2) (Fragment) , partial (9%) |
| Mapped public sequence ID | BG451783 |
| Gene Ontology | GO:0004089 GO:0008152 GO:0015977 GO:0006730 |
| KEGG | K01673 |
| Transporter | 2.A.53 2.A.53.8.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT45635 BG451783 TCMT59961 TCMT59962 |
| Target sequence | gaattattagttcagttctccgatcaaaggcacctttagtggcttcatacgtccatggag |