| Detail of Probeset Mtr.33771.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.33771.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
BI267981 /FEA=mRNA /DEF=weakly similar to UP|O23233 (O23233) Serine C-palmitoyltransferase like protein, partial (15%) |
| Mapped public sequence ID |
BI267981 |
| Gene Ontology |
GO:0004758 GO:0005515 GO:0005575 GO:0006665 |
| KEGG |
K00654 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT43296 BI267981
|
| Target sequence |
gctaatgatggcttcagctgctgttaatttcgtgaacactacattaaattgggttacata
tgctttagatgcaccttctgcaagagctatagtttttggatataattttggtggacattt
atttattgaagtttttctcttggtggtcatacttttctt |
