| Detail of Probeset Mtr.33786.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.33786.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BI269025 /FEA=mRNA /DEF=weakly similar to UP|Q8TXQ7 (Q8TXQ7) Homolog of ABC-type nitrate/sulfonate/taurine/bicarbonate transport systems, ATPase component, partial (26%) |
| Mapped public sequence ID |
BI269025 |
| Gene Ontology |
GO:0005381 GO:0005524 GO:0006826 GO:0009898 GO:0015417 GO:0015846 GO:0042626 |
| KEGG |
K02049 |
| Transporter |
3.A.1 3.A.1.16 3.A.1.16.2 3.A.1.16.3 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BI269025 |
| Target sequence |
gcgcgcccacgattcgttccatgaacctgaccttcgaccacngtccacaagcacttcggc
ggacctgccggtcgtcgatggcttcaccagcgaattcaagaccggcgagctggtcgcgct
ggtcggcccgtcgggctgcggcaagtcgaccctgctgcacctggccgccggcctggaaaa
gccgacgcaagggcaggtgctggccgatggcaa |