Detail of Probeset Mtr.34155.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.34155.1.S1_at |
Species |
Medicago truncatula |
Annotation |
BQ139527 /FEA=mRNA /DEF=weakly similar to UP|ACC3_LYCES (P10967) 1-aminocyclopropane-1-carboxylate oxidase homolog (Protein E8), partial (16%) |
Mapped public sequence ID |
BQ139527 |
Gene Ontology |
GO:0005506 GO:0005575 GO:0008152 GO:0009693 GO:0009815 GO:0016491 |
KEGG |
K00475 K05277 K05278 K06892 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT59288 |
Target sequence |
attgataatcaagaccctagtattcatcaaggaattgtcgacaatatcaagg |