Detail of Probeset Mtr.34391.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.34391.1.S1_at
Species Medicago truncatula
Annotation BQ146713 /FEA=mRNA /DEF=similar to UP|Q9FKM3 (Q9FKM3) Similarity to AAA-type ATPase, partial (5%)
Mapped public sequence ID BQ146713
Gene Ontology GO:0005739 GO:0005743 GO:0006461 GO:0016226 GO:0016887 GO:0042623
KEGG K08900
Transporter 3.A.16.1.2
Transcription Factor
Mapped unigene in the TRICHOME database BQ146713  TCMT60451  
Target sequence gcagcagcatgcagtgtagtgtaattcaacaaaaaatgaatattgaagatggcttatgaa
atacaggggaaggaagaagctntagccttctaaattttgacctatgaaa