| Detail of Probeset Mtr.34593.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.34593.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | BQ152796 /FEA=mRNA /DEF=similar to UP|Q9FNE2 (Q9FNE2) Glutaredoxin-like protein (AT5g40370/MPO12_80), partial (28%) |
| Mapped public sequence ID | BQ152796 |
| Gene Ontology | GO:0004364 GO:0005575 GO:0006979 GO:0031154 GO:0043295 GO:0045454 GO:0050661 GO:0009405 |
| KEGG | K03676 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT41836 BQ143945 AW773589 |
| Target sequence | caacaactaacttgcaaaaccagggtaagctggtacccctgctgacatctgctggagcta |