Detail of Probeset Mtr.34669.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.34669.1.S1_s_at
Species Medicago truncatula
Annotation BQ158887 /FEA=mRNA /DEF=similar to GB|AAO73340.1|30103105|AY186611 ribosomal protein L5 {Arabidopsis thaliana;} , partial (15%)
Mapped public sequence ID BQ158887
Gene Ontology GO:0003735 GO:0005515 GO:0005829 GO:0005840 GO:0006364 GO:0006414 GO:0008097 GO:0022625 GO:0042273 GO:0009790 GO:0000003 GO:0002119 GO:0009792 GO:0010171 GO:0040007 GO:0040010 GO:0040035 GO:0000027 GO:0003723 GO:0006412
KEGG K02932
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database BQ146996  BI268093  
BQ158887  TCMT49463  
AA660801  AL369937  
DY615789  AW689027  
Target sequence ctgcgtctgcaacaatggtttatgttaaggctcagaaatccaaggcttactttcaagcgt
taccaagtcaagaanaanaaaaaaaaattttttttngactgattatcgtgctcgtattcg
cctgattaaccaggataagaacaagt