Detail of Probeset Mtr.34891.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.34891.1.S1_at
Species Medicago truncatula
Annotation CX527183 /FEA=mRNA /DEF=similar to UP|Q6KAI5 (Q6KAI5) CLIP-associating protein 1-like, partial (21%)
Mapped public sequence ID CX527183
Gene Ontology GO:0001578 GO:0005515 GO:0005794 GO:0005828 GO:0005881 GO:0005938 GO:0007026 GO:0007163 GO:0008017 GO:0010458 GO:0030981 GO:0031592 GO:0043515 GO:0051010 GO:0000022 GO:0000070 GO:0000775 GO:0000776 GO:0000922 GO:0005525 GO:0005634 GO:0005737 GO:0005813 GO:0005815 GO:0005819 GO:0005827 GO:0005875 GO:0005876 GO:0007051 GO:0007052 GO:0007067 GO:0007282 GO:0007411 GO:0016325 GO:0019827 GO:0030723 GO:0040001 GO:0043148 GO:0045169 GO:0045172 GO:0046602 GO:0048477 GO:0051225 GO:0051315
KEGG K16812
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database CX527183  
Target sequence ttaataatcgattctcaaacgcgcttccaaattcaattcacttcctctcttcaactgcgc
ttaacttcccgaagtgattattagatctgaagcagatccaaatggaggaagcgtt