Detail of Probeset Mtr.3503.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.3503.1.S1_at
Species Medicago truncatula
Annotation AW736514 /FEA=mRNA /DEF=homologue to emb|X51598.1|PS16SVAL P.sativum 16S rRNA & tRNA-Val chloroplast genes, partial (9%)
Mapped public sequence ID AW736514
Gene Ontology GO:0004738 GO:0004742 GO:0006086 GO:0045250 GO:0045254
KEGG K00627
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT43685  AW736514  
Target sequence ccttcggatttgatccaggagacgattttaccctcggtcatagtggaactgagtgcaggc
atgaagatttcacggatcttagcttggattttgaa