| Detail of Probeset Mtr.3503.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.3503.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AW736514 /FEA=mRNA /DEF=homologue to emb|X51598.1|PS16SVAL P.sativum 16S rRNA & tRNA-Val chloroplast genes, partial (9%) |
| Mapped public sequence ID |
AW736514 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0008150 |
| KEGG |
K00627 K00645 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMS40719 AW736514
BG644545 AW776956
AW776248 |
| Target sequence |
ttgagtttcattcttgcgaacgtactccccaggcgggatacttaacgcgttagctacagc
attgcacgggtcgatacgcacagccacctagtatccatcgtttacggctaggactactgg
|