| Detail of Probeset Mtr.35135.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.35135.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
CX533880 /FEA=mRNA /DEF=similar to UP|Q8H9B4 (Q8H9B4) UDP-glucose:sterol 3-O-glucosyltransferase, partial (17%) |
| Mapped public sequence ID |
CX533880 |
| Gene Ontology |
GO:0005737 GO:0005975 GO:0016125 GO:0016906 GO:0030259 GO:0051505 GO:0051506 GO:0051507 GO:0051508 GO:0051509 |
| KEGG |
K05841 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CX533880 |
| Target sequence |
acaatgccgtggacgtaagtttgtttgctgacatggtctaatcctgcattcagttatcta
tatttttgttgagagactcacattggaaatgatatgacctgaaaatatttagaaattggg
ggcatccctcaccttataggctggtttt |