| Detail of Probeset Mtr.35240.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.35240.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | CX539544 /FEA=mRNA /DEF=UP|Q5UU21 (Q5UU21) Xyloglucan endotransglycosylase hydrolase 1, partial (56%) |
| Mapped public sequence ID | CX539544 |
| Gene Ontology | GO:0005619 GO:0006112 GO:0016810 GO:0030476 GO:0007047 GO:0009277 GO:0009986 GO:0030445 GO:0030446 |
| KEGG | K08235 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40687 TCMS40688 TCMT55849 TCMT55848 |
| Target sequence | gggaagaccagcaacttttaatcaagattttcatgtcacgtggtcagaaccccatatcaa |