| Detail of Probeset Mtr.35274.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.35274.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
CX540693 /FEA=mRNA /DEF=similar to UP|Q6S4Y1 (Q6S4Y1) DEAD box RNA helicase, partial (14%) |
| Mapped public sequence ID |
CX540693 |
| Gene Ontology |
GO:0003723 GO:0003724 GO:0005634 GO:0006396 GO:0008186 |
| KEGG |
K01509 K01529 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ggcaggttaatgtgtggcgatttacttgattgacaaaacaagttatggagctggttattt
tgcggtccggttgactcatacatactttgttgataattggatacggtagatgacagtgat
ggtgaagcttctccttatcccttaaaggttcagatgtgaag |
