| Detail of Probeset Mtr.36533.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.36533.1.S1_at |
| Species | Medicago truncatula |
| Annotation | BQ137220 /FEA=mRNA /DEF=similar to PIR|G86476|G86476 protein F15O4.37 [imported] - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (4%) |
| Mapped public sequence ID | BQ137220 |
| Gene Ontology | GO:0004565 GO:0005515 GO:0005990 |
| KEGG | K01190 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | BQ137220 BQ156184 TCMT40110 |
| Target sequence | gaagcttacatgcatatggacgcagttcatgtctagctatatgtataataaaaggtgtag |