| Detail of Probeset Mtr.36822.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.36822.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | CX529328 /FEA=mRNA /DEF=similar to UP|Q9M5X2 (Q9M5X2) Heat-shock protein 80 (Fragment), partial (22%) |
| Mapped public sequence ID | CX529328 |
| Gene Ontology | GO:0005515 GO:0005625 GO:0005813 GO:0030235 GO:0030911 GO:0031152 GO:0045335 GO:0045429 |
| KEGG | K04079 K10999 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT40618 TCMT40185 CX529328 AJ548257 |
| Target sequence | tggattcagccttgatgagcccaacacctttggcaacaggatt |