| Detail of Probeset Mtr.36843.1.S1_a_at in Chip AffyMedicago |
| Probeset ID |
Mtr.36843.1.S1_a_at |
| Species |
Medicago truncatula |
| Annotation |
CX531936 /FEA=mRNA /DEF=similar to UP|Q8VXD3 (Q8VXD3) N-acetylglucosaminyltransferase I , partial (13%) |
| Mapped public sequence ID |
CX531936 |
| Gene Ontology |
GO:0003827 GO:0005975 GO:0008340 GO:0008344 GO:0008375 GO:0016021 GO:0016319 GO:0018279 |
| KEGG |
K00726 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CX531936 DY617136
|
| Target sequence |
ataacgcacaccatcccatgtatcttgtagagatcaagattttgtcttgtggagtattgt
ggaacacgataacgcacaccatcccatgtatcttgtagagatcaa |