| Detail of Probeset Mtr.36909.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.36909.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
MTUCN52TV /FEA=mRNA /DEF=similar to PDB|1VCR_A|47169444|1VCR_A Chain A, An Icosahedral Assembly Of Light-Harvesting Chlorophyll AB Protein Complex From Pea Thylakoid Membranes. {Pisum sativum;} , partial (16%) |
| Mapped public sequence ID |
MTUCN52TV |
| Gene Ontology |
|
| KEGG |
K08912 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
cttgggatgtgttttcccggagcttttgtctcgcaatggtgtttttttcggtgaggctgt
atggttctaggccggatccccg |
