Detail of Probeset Mtr.37250.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.37250.1.S1_at
Species Medicago truncatula
Annotation TC100215 /FEA=mRNA /DEF=weakly similar to UP|Q94AG3 (Q94AG3) At1g72160/T9N14_8, partial (47%)
Mapped public sequence ID TC100215
Gene Ontology GO:0003674 GO:0005575 GO:0008150 GO:0000910 GO:0005628 GO:0005634 GO:0005829 GO:0006893 GO:0008525 GO:0008526 GO:0015914 GO:0030437 GO:0031321 GO:0032153 GO:0051286
KEGG K01101 K15352 K17210
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database BQ137617  TCMT42277  
AW773799  
Target sequence tggggaattccattactagctgatgaaagaagtgatgtgattcttctcaagttcttgaga
gctagggattttaaggtgaaggaggctttcactatgatcaaacaaaccgtgctt