| Detail of Probeset Mtr.37266.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.37266.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
TC100243 /FEA=mRNA /DEF=homologue to gb|AF036495.1|AF036495 Hamamelis virginiana large subunit 26S ribosomal RNA gene, partial sequence, partial (14%) |
| Mapped public sequence ID |
TC100243 |
| Gene Ontology |
GO:0003674 GO:0003690 GO:0003700 GO:0005575 GO:0008134 GO:0008150 GO:0008283 GO:0009303 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0000785 GO:0001701 GO:0006301 GO:0006511 |
| KEGG |
K05692 K07497 K10573 K12697 |
| Transporter |
9.A.5 9.A.5.1.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMS40020 CB891727
CX526822 CX528389
AW692464 BE318774
|
| Target sequence |
catgccatggaatcgagagctccaagtgggccatttttggtaagcagaactggcgatgcg
ggatgaaccggaagctgggttacggtgcccaactgcgcgctaacctagaccccacaaagg
gtgttggtcgattaagacagcaggacgg |