| Detail of Probeset Mtr.37364.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37364.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC100515 /FEA=mRNA /DEF=similar to PIR|T02039|T02039 acidic ribosomal protein P1a - maize {Zea mays;} , complete |
| Mapped public sequence ID | TC100515 |
| Gene Ontology | GO:0003735 GO:0005515 GO:0005811 GO:0006412 GO:0006414 GO:0022625 |
| KEGG | K02942 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS41062 BQ150339 TCMT40351 TCMT41400 TCMT41928 |
| Target sequence | atgagttccggcgaattgggctgcatttacgccaccttgatcctccacgacgatggaatc |