| Detail of Probeset Mtr.37386.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37386.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC100554 /FEA=mRNA /DEF=similar to UP|Q9FQ95 (Q9FQ95) In2-1 protein, partial (96%) |
| Mapped public sequence ID | TC100554 |
| Gene Ontology | GO:0004364 GO:0005737 GO:0016656 GO:0019853 GO:0045174 GO:0004734 GO:0006726 GO:0006728 GO:0016782 GO:0042803 |
| KEGG | K00799 K03599 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT40300 TCMT41247 AW686878 BE322173 |
| Target sequence | gttgtacgtaagttatagctgcccttttgcacaacgtacgtggatcactagaaactacaa |