| Detail of Probeset Mtr.37409.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.37409.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC100599 /FEA=mRNA /DEF=similar to GB|BAA97483.1|8885553|AB025604 ripening-related protein-like; hydrolase-like {Arabidopsis thaliana;} , partial (46%) |
| Mapped public sequence ID |
TC100599 |
| Gene Ontology |
GO:0003824 GO:0005575 GO:0005634 GO:0005737 GO:0005829 GO:0006206 GO:0008152 GO:0008252 GO:0047405 |
| KEGG |
K07025 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT46528 |
| Target sequence |
aaaccattttgctcaccctaaatcaagtctagtagtct |