Detail of Probeset Mtr.37409.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.37409.1.S1_at
Species Medicago truncatula
Annotation TC100599 /FEA=mRNA /DEF=similar to GB|BAA97483.1|8885553|AB025604 ripening-related protein-like; hydrolase-like {Arabidopsis thaliana;} , partial (46%)
Mapped public sequence ID TC100599
Gene Ontology GO:0003824 GO:0005575 GO:0005634 GO:0005737 GO:0005829 GO:0006206 GO:0008152 GO:0008252 GO:0047405
KEGG K07025
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT46528  
Target sequence aaaccattttgctcaccctaaatcaagtctagtagtct