| Detail of Probeset Mtr.37418.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37418.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC100614 /FEA=mRNA /DEF=similar to UP|Q40363 (Q40363) NuM1 protein, partial (30%) |
| Mapped public sequence ID | TC100614 |
| Gene Ontology | GO:0003723 GO:0005730 GO:0005732 GO:0006364 GO:0007000 GO:0042162 GO:0042254 |
| KEGG | K11294 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT40565 BG448933 DY617262 |
| Target sequence | ctctcttctgttcattatgcctaaatcaagcaagaaatccgctaccaaagttgatgctgc |