Detail of Probeset Mtr.37488.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.37488.1.S1_at
Species Medicago truncatula
Annotation TC100765 /FEA=mRNA /DEF=weakly similar to UP|CC28_YEAST (P00546) Cell division control protein 28 , partial (10%)
Mapped public sequence ID TC100765
Gene Ontology GO:0001558 GO:0001824 GO:0005515 GO:0005524 GO:0005634 GO:0005737 GO:0006355 GO:0006468 GO:0006915 GO:0007067 GO:0007088 GO:0008283 GO:0050684 GO:0005575
KEGG K08818
Transporter
Transcription Factor WRKY
Mapped unigene in the TRICHOME database TCMT43392  
Target sequence tagttgctcagacaggtacttatgctagagctggattcatgaaaaatcaagaccaatgcc
tgtgttaacctcacttttacaacttctttccacattaatgatcatatactaagaatgatg
tgattgtaaaacacagtgatcggctt