| Detail of Probeset Mtr.37528.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37528.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC100855 /FEA=mRNA /DEF=similar to UP|Q84T14 (Q84T14) Vacuolar ATPase subunit E (Fragment), complete |
| Mapped public sequence ID | TC100855 |
| Gene Ontology | GO:0000221 GO:0008553 GO:0015992 GO:0060041 |
| KEGG | K02150 |
| Transporter | 3.A.2 3.A.2.2.3 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42188 AL381302 BQ145503 |
| Target sequence | aggtgtggtattggcttctcatgatggaaagattgtgtttgaaaatacacttgatgcgcg |