| Detail of Probeset Mtr.377.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.377.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1418.m00051 /FEA=mRNA /DEF=AC126781.22 101589 105883 mth2-12m15 weakly similar to TAIR|gene:2175583-GOpep .1 68412.m06457 expressed protein similar to unknown protein (ref|NP_004732.1) |
| Mapped public sequence ID | 1418.m00051 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | agttgcattatctaagaaatgtgtatgggtctatctctctgcaggatggtgccgaga |