| Detail of Probeset Mtr.37792.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37792.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC101426 /FEA=mRNA /DEF=similar to GB|AAR24712.1|38603934|BT010934 At5g56260 {Arabidopsis thaliana;} , partial (48%) |
| Mapped public sequence ID | TC101426 |
| Gene Ontology | GO:0005515 GO:0006401 GO:0008428 GO:0008757 GO:0009234 GO:0050790 GO:0004565 GO:0005990 |
| KEGG | K01190 K02553 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | BQ145688 TCMT42119 TCMT41772 BQ145922 |
| Target sequence | tgtgtcaggttggtgttagagctttggcttctcatccacttaaatccaataaaaacggta |