| Detail of Probeset Mtr.37872.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37872.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC101598 /FEA=mRNA /DEF= |
| Mapped public sequence ID | TC101598 |
| Gene Ontology | GO:0003674 GO:0005515 GO:0005575 GO:0005634 GO:0006916 GO:0007165 GO:0007259 GO:0008284 GO:0005768 GO:0008150 GO:0043328 GO:0045324 |
| KEGG | K01072 K13127 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT49963 |
| Target sequence | gtaaagtatgaccttgctggcattaaagatggtgaccaaggaccacttacatccacaatg |