| Detail of Probeset Mtr.38265.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.38265.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC102408 /FEA=mRNA /DEF=weakly similar to UP|Q9SQK3 (Q9SQK3) Ankyrin repeat protein EMB506, partial (43%) |
| Mapped public sequence ID |
TC102408 |
| Gene Ontology |
GO:0001702 GO:0005515 GO:0005575 GO:0007507 GO:0008013 GO:0008150 GO:0009953 GO:0030178 GO:0030877 GO:0042074 GO:0046330 GO:0048264 |
| KEGG |
K11420 |
| Transporter |
1.A.1 1.A.1.4.4 1.A.1.4.5 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tcttctacggaaagggtgcagtcctcatatccaggataaggatggagctactccactttc
atatgcagtttgagttggtgccaagcaaactgtgaaattatgatcaaaatacatgttgat
gtcaat |