| Detail of Probeset Mtr.38569.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.38569.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC103070 /FEA=mRNA /DEF=similar to UP|Q94A50 (Q94A50) AT3g55070/T15C9_70, partial (40%) |
| Mapped public sequence ID |
TC103070 |
| Gene Ontology |
GO:0003674 GO:0003779 GO:0005575 GO:0005624 GO:0005819 GO:0005826 GO:0005856 GO:0005887 GO:0007010 GO:0007155 GO:0008150 GO:0015629 GO:0016363 GO:0033033 GO:0048821 GO:0048822 |
| KEGG |
K13163 K23249 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BG448545 |
| Target sequence |
atgattgaaaatgtgaaccctgccattggcttcaagctactgtggctttcagattgggaa
agtttgcaaagttactcttacgaccctttcattaaccagtcaatatatttatttatatgt
gttccggtctttacttaaagcttgtacatatgtaaactgtttttagtatcacttggatga
cttaaacatgtgcatagattgatttagtattttccattgta |