| Detail of Probeset Mtr.38571.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.38571.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC103076 /FEA=mRNA /DEF=similar to UP|CNG6_ARATH (O82226) Probable cyclic nucleotide-gated ion channel 6 (AtCNGC6) (Cyclic nucleotide- and calmodulin-regulated ion channel 6), partial (17%) |
| Mapped public sequence ID | TC103076 |
| Gene Ontology | |
| KEGG | K05391 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT54413 |
| Target sequence | aacttcaacagtttctccatgaggttgtgcatctgcgacctactgttgaaagatgtttga |