| Detail of Probeset Mtr.388.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.388.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1421.m00043 /FEA=mRNA /DEF=AC134322.25 42524 46778 mth2-17i21 similar to TAIR|gene:1945404-GOpep .1 68408.m02594 phosphomethylpyrimidine kinase probable thiamin biosynthetic, partial (94%) |
| Mapped public sequence ID | 1421.m00043 |
| Gene Ontology | GO:0008972 GO:0009228 |
| KEGG | K00788 K00877 K00941 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | aggtggtgcaaccattgtccaattaagggaaa |