| Detail of Probeset Mtr.38882.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.38882.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC103729 /FEA=mRNA /DEF=homologue to PIR|JC7770|JC7770 chloroplast division protein, FtsZ2-1 - Arabidopsis thaliana chloroplast {Arabidopsis thaliana;} , partial (9%) |
| Mapped public sequence ID |
TC103729 |
| Gene Ontology |
GO:0000910 GO:0000917 GO:0003924 GO:0005515 GO:0051258 |
| KEGG |
K03531 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT54135 |
| Target sequence |
gtcttaccctaaataatatctcaattattattattattattaaatccattaatcaggtac
tactgcaaccgaattgcatcctccacactttgaatttctgatttttctaaattcacacat
taattaccacttatgagtttggatact |