Detail of Probeset Mtr.39197.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.39197.1.S1_at
Species Medicago truncatula
Annotation TC104395 /FEA=mRNA /DEF=similar to UP|Q93ZG9 (Q93ZG9) AT4g25340/T30C3_20, partial (16%)
Mapped public sequence ID TC104395
Gene Ontology GO:0003674 GO:0005813 GO:0006457 GO:0003755 GO:0005527 GO:0005730 GO:0016072 GO:0042254 GO:0051598
KEGG K01802
Transporter
Transcription Factor C2H2
Mapped unigene in the TRICHOME database TCMT44029  
Target sequence acagtgatatggaaatgtacacatcttcgcctgtccggagtagtggagtcgttat