Detail of Probeset Mtr.39601.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.39601.1.S1_s_at
Species Medicago truncatula
Annotation TC105238 /FEA=mRNA /DEF=
Mapped public sequence ID TC105238
Gene Ontology GO:0004565 GO:0005515 GO:0005990 GO:0002088 GO:0005212 GO:0005792 GO:0005887 GO:0006833 GO:0007601 GO:0015250 GO:0015722 GO:0030104 GO:0046691
KEGG K01190 K09873
Transporter 1.A.8 1.A.8.10.1 1.A.8.10.2
Transcription Factor
Mapped unigene in the TRICHOME database TCMT40152  BQ145376  
BQ153373  
Target sequence attattttgtacatgcttggcctagcaggttcttagtcagcaggtccaccactcaatcaa
tgttataatttcgcctctgcttcgttgtatgattgattcaacttctttgttttttctc