Detail of Probeset Mtr.39939.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.39939.1.S1_at
Species Medicago truncatula
Annotation TC106116 /FEA=mRNA /DEF=similar to PIR|A48084|A48084 STE11 protein kinase homolog NPK1 - common tobacco {Nicotiana tabacum;} , partial (9%)
Mapped public sequence ID TC106116
Gene Ontology GO:0000165 GO:0004709 GO:0005515 GO:0005524 GO:0005938 GO:0006468 GO:0009653 GO:0030587
KEGG K08282 K11228
Transporter
Transcription Factor WRKY
Mapped unigene in the TRICHOME database TCMT45439  
Target sequence ttctcccagctaatacctgtcttgtaagggcgttcatccggtcttcgtgaacgtcaattg
aaaacacgagttgctgcagttttgctggggttgtcaatattatatatatccgatctgatc
tccgatttaatcgttgtgtcattttgacatatctcacatgc