| Detail of Probeset Mtr.40031.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40031.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC106359 /FEA=mRNA /DEF=homologue to UP|METM_LYCES (P43282) S-adenosylmethionine synthetase 3 (Methionine adenosyltransferase 3) (AdoMet synthetase 3) , complete |
| Mapped public sequence ID | TC106359 |
| Gene Ontology | GO:0000287 GO:0004478 GO:0005524 GO:0005737 GO:0006555 GO:0006730 GO:0030955 GO:0045335 GO:0048269 GO:0006556 |
| KEGG | K00789 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT40217 BG646417 AL367355 |
| Target sequence | gagaactttgacttcaggcctggtatgattgctatcaaccttgacctcacaagaggtggc |