Detail of Probeset Mtr.40081.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.40081.1.S1_at
Species Medicago truncatula
Annotation TC106459 /FEA=mRNA /DEF=similar to UP|O23645 (O23645) RSZp21 protein, partial (42%)
Mapped public sequence ID TC106459
Gene Ontology GO:0000398 GO:0005515 GO:0005634 GO:0008380 GO:0001703 GO:0002009 GO:0002119 GO:0003723 GO:0007275 GO:0008406 GO:0009790 GO:0009792 GO:0010171 GO:0040007 GO:0040010 GO:0040026 GO:0040035 GO:0048477
KEGG K12439 K13897 K16401
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT48830  
Target sequence ctcaggtttgttcttaccgagtaggagttaagtggatgctgttgttttaaatttgcgtac
gttcaaaaaacacaaacagttaacaaagaaacgtgctactgcagcagctgct